ID: 1118294568_1118294575

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1118294568 1118294575
Species Human (GRCh38) Human (GRCh38)
Location 14:64557384-64557406 14:64557408-64557430
Sequence CCCAATATATAAAATAAGAAGAA AAGGGGAAAGAGAAGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 210, 4: 2265} {0: 2, 1: 24, 2: 206, 3: 1091, 4: 4687}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!