ID: 1118329657_1118329663

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1118329657 1118329663
Species Human (GRCh38) Human (GRCh38)
Location 14:64805489-64805511 14:64805525-64805547
Sequence CCCACCTCCTTCACTTAACACTA GAGCCAGTATAAATGGCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 212} {0: 2, 1: 0, 2: 0, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!