ID: 1118334980_1118334981

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118334980 1118334981
Species Human (GRCh38) Human (GRCh38)
Location 14:64845574-64845596 14:64845587-64845609
Sequence CCAGACTATAGGACTGTAGAGAT CTGTAGAGATGAAAAGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 0, 2: 2, 3: 31, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!