ID: 1118351858_1118351861

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1118351858 1118351861
Species Human (GRCh38) Human (GRCh38)
Location 14:64977836-64977858 14:64977861-64977883
Sequence CCTGTGCCTATCAATGTCCTAAT CTTTTTTTTTTTTTTTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132} {0: 7194, 1: 95351, 2: 66312, 3: 83357, 4: 126880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!