ID: 1118463876_1118463892

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1118463876 1118463892
Species Human (GRCh38) Human (GRCh38)
Location 14:66013653-66013675 14:66013701-66013723
Sequence CCGCCGGCAGGCGCCGCCGATGT GCGCCGCTGCCGGTAGTGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 2, 3: 11, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!