ID: 1118477993_1118477997

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1118477993 1118477997
Species Human (GRCh38) Human (GRCh38)
Location 14:66136293-66136315 14:66136313-66136335
Sequence CCGCTGGAAGCCGAGCAAGGCAT CATTAACCCCTCCTGGGCGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!