ID: 1118525851_1118525853

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1118525851 1118525853
Species Human (GRCh38) Human (GRCh38)
Location 14:66641620-66641642 14:66641653-66641675
Sequence CCAACCATCAATAGCTGATAGAA ACAAAAAAAAAAAAAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 162} {0: 2, 1: 144, 2: 2170, 3: 18882, 4: 79470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!