ID: 1118529983_1118529988

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1118529983 1118529988
Species Human (GRCh38) Human (GRCh38)
Location 14:66693576-66693598 14:66693613-66693635
Sequence CCCAGCTCCAGAAGAGAGAGGAA CTATTTCGGTCCCCTCTAATTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 65, 3: 222, 4: 768} {0: 1, 1: 0, 2: 0, 3: 6, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!