ID: 1118537392_1118537398

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1118537392 1118537398
Species Human (GRCh38) Human (GRCh38)
Location 14:66783057-66783079 14:66783089-66783111
Sequence CCTACAAAAGCCTGTTTGTCTAG AAGGACAAGGGTCACCTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 218} {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!