ID: 1118564242_1118564245

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118564242 1118564245
Species Human (GRCh38) Human (GRCh38)
Location 14:67121971-67121993 14:67121986-67122008
Sequence CCAGAGCATTATTATCAAATTGG CAAATTGGAGCCCAACCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 134} {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!