ID: 1118610149_1118610163

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1118610149 1118610163
Species Human (GRCh38) Human (GRCh38)
Location 14:67533382-67533404 14:67533432-67533454
Sequence CCGCGAGCTCGCTGGAGGTGAGC CTGGGGCTGCGCCGCGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82} {0: 1, 1: 0, 2: 5, 3: 44, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!