ID: 1118626961_1118626963

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1118626961 1118626963
Species Human (GRCh38) Human (GRCh38)
Location 14:67668394-67668416 14:67668424-67668446
Sequence CCTAAAACAGGACACATTGTCTC ATTCAAAGGCAGAAAGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 221} {0: 1, 1: 1, 2: 7, 3: 84, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!