ID: 1118641425_1118641431

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1118641425 1118641431
Species Human (GRCh38) Human (GRCh38)
Location 14:67796294-67796316 14:67796326-67796348
Sequence CCAACCTCTGCCTCCCAGGTTCA CGTGCCTCAGGCTCCCGAGCTGG
Strand - +
Off-target summary {0: 148, 1: 431, 2: 871, 3: 1305, 4: 4869} {0: 1, 1: 0, 2: 115, 3: 1500, 4: 3716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!