ID: 1118641427_1118641431

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118641427 1118641431
Species Human (GRCh38) Human (GRCh38)
Location 14:67796304-67796326 14:67796326-67796348
Sequence CCTCCCAGGTTCAAGTGATTCTC CGTGCCTCAGGCTCCCGAGCTGG
Strand - +
Off-target summary {0: 20599, 1: 62494, 2: 120157, 3: 154110, 4: 162194} {0: 1, 1: 0, 2: 115, 3: 1500, 4: 3716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!