ID: 1118668664_1118668667

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118668664 1118668667
Species Human (GRCh38) Human (GRCh38)
Location 14:68099141-68099163 14:68099154-68099176
Sequence CCCCAGCTGCTAATCACTTCCTA TCACTTCCTACTCTTTGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271} {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!