ID: 1118669201_1118669205

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1118669201 1118669205
Species Human (GRCh38) Human (GRCh38)
Location 14:68103591-68103613 14:68103635-68103657
Sequence CCCATTTCTCATTTCTTTTTCCT GTGTTAGTACAAATTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 31, 3: 256, 4: 2374} {0: 1, 1: 0, 2: 1, 3: 5, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!