ID: 1118690232_1118690237

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1118690232 1118690237
Species Human (GRCh38) Human (GRCh38)
Location 14:68331554-68331576 14:68331603-68331625
Sequence CCTGTGACTATAGTTTTCATGCA AACTGGGTTCTGCAATTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 0, 2: 2, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!