ID: 1118694331_1118694336

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1118694331 1118694336
Species Human (GRCh38) Human (GRCh38)
Location 14:68369612-68369634 14:68369663-68369685
Sequence CCTGTTCTTTCAAATAGGTGCCA ATATGTTATGCCTGGCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!