ID: 1118723788_1118723793

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1118723788 1118723793
Species Human (GRCh38) Human (GRCh38)
Location 14:68612452-68612474 14:68612490-68612512
Sequence CCTGGTCCTATGGGCCAGCTCTG TTGCCATCAAGGAATACAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 171} {0: 1, 1: 0, 2: 7, 3: 67, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!