ID: 1118734647_1118734654

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1118734647 1118734654
Species Human (GRCh38) Human (GRCh38)
Location 14:68692551-68692573 14:68692577-68692599
Sequence CCCCAAAGCCAGCTTCCAGAGAG ATCCTGAATGAGGTCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 259} {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!