ID: 1118815988_1118815994

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1118815988 1118815994
Species Human (GRCh38) Human (GRCh38)
Location 14:69314372-69314394 14:69314422-69314444
Sequence CCATGAGAGTTCAAAGCCCTGGC AGGCAATGTGCAGCAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182} {0: 1, 1: 0, 2: 0, 3: 22, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!