ID: 1118860432_1118860437

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118860432 1118860437
Species Human (GRCh38) Human (GRCh38)
Location 14:69658800-69658822 14:69658815-69658837
Sequence CCTGGCAGGCGGTTTCAGGGAGA CAGGGAGAGCAGAGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 208} {0: 1, 1: 0, 2: 17, 3: 128, 4: 1172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!