ID: 1118872149_1118872158

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1118872149 1118872158
Species Human (GRCh38) Human (GRCh38)
Location 14:69752463-69752485 14:69752503-69752525
Sequence CCTCTCAGTCATCTTGAATCTCT CTGTTAAAAAGGAGATACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 235} {0: 1, 1: 0, 2: 2, 3: 34, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!