ID: 1118923125_1118923131

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1118923125 1118923131
Species Human (GRCh38) Human (GRCh38)
Location 14:70167998-70168020 14:70168039-70168061
Sequence CCCAGGGCCATAAGGGTCAGGTT GACCCGAATAGTGGTTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 103} {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!