ID: 1118931649_1118931658

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1118931649 1118931658
Species Human (GRCh38) Human (GRCh38)
Location 14:70247506-70247528 14:70247537-70247559
Sequence CCCCTGCTGATCACCTTCAAGGG CTTCCAGGGAAGTGAAATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 20, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!