ID: 1119012600_1119012604

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1119012600 1119012604
Species Human (GRCh38) Human (GRCh38)
Location 14:71010953-71010975 14:71010966-71010988
Sequence CCTGATTCTGTAACAATGGAAAC CAATGGAAACAGTAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154} {0: 1, 1: 0, 2: 2, 3: 49, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!