ID: 1119107560_1119107566

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1119107560 1119107566
Species Human (GRCh38) Human (GRCh38)
Location 14:71938818-71938840 14:71938866-71938888
Sequence CCACCAAAGCCCAGTAATAGGCC AGTTACCTGCAGAAGATGACAGG
Strand - +
Off-target summary {0: 13, 1: 161, 2: 162, 3: 88, 4: 160} {0: 1, 1: 29, 2: 225, 3: 173, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!