ID: 1119111872_1119111877

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1119111872 1119111877
Species Human (GRCh38) Human (GRCh38)
Location 14:71982306-71982328 14:71982320-71982342
Sequence CCTCCCTCCTTCTGTTTATTTTT TTTATTTTTTATTAAGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 358, 4: 3288} {0: 1, 1: 9, 2: 287, 3: 1870, 4: 10170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!