ID: 1119130507_1119130515

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1119130507 1119130515
Species Human (GRCh38) Human (GRCh38)
Location 14:72168286-72168308 14:72168329-72168351
Sequence CCACAGGCCTCGGAATGTGGCAA GGCTCAGGAAAGGCTCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99} {0: 1, 1: 0, 2: 2, 3: 18, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!