ID: 1119132582_1119132583

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1119132582 1119132583
Species Human (GRCh38) Human (GRCh38)
Location 14:72188122-72188144 14:72188140-72188162
Sequence CCTTGGGAAGAAATATGAGTGTT GTGTTAGATAAGCTTCGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 248} {0: 1, 1: 4, 2: 59, 3: 158, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!