ID: 1119183680_1119183683

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1119183680 1119183683
Species Human (GRCh38) Human (GRCh38)
Location 14:72621281-72621303 14:72621296-72621318
Sequence CCACTGTAGAGACTTCCTTGCAT CCTTGCATACAGGAGCTGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149} {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!