ID: 1119196138_1119196143

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1119196138 1119196143
Species Human (GRCh38) Human (GRCh38)
Location 14:72717978-72718000 14:72718001-72718023
Sequence CCTGATTCAAGCTGGGCCAATCA GATCCTACCTCCAAGGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 12, 3: 65, 4: 198} {0: 1, 1: 0, 2: 3, 3: 14, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!