ID: 1119262444_1119262460

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1119262444 1119262460
Species Human (GRCh38) Human (GRCh38)
Location 14:73245739-73245761 14:73245772-73245794
Sequence CCCCTCCTGGCCGATTTCCCCAT GCTCCTGGCCGCGGGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 388} {0: 1, 1: 0, 2: 2, 3: 24, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!