ID: 1119324303_1119324309

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1119324303 1119324309
Species Human (GRCh38) Human (GRCh38)
Location 14:73750517-73750539 14:73750546-73750568
Sequence CCAAAGGGTGTTGAGGTATGGGG AGAGGTGAGCTGGAGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125} {0: 1, 1: 0, 2: 4, 3: 79, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!