ID: 1119407717_1119407722

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1119407717 1119407722
Species Human (GRCh38) Human (GRCh38)
Location 14:74409232-74409254 14:74409277-74409299
Sequence CCACGCCAGGCTAATTTTCAATT TCTCCTTGTGTTGCTCATGCTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 481, 3: 8903, 4: 37949} {0: 1, 1: 4, 2: 223, 3: 3035, 4: 22881}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!