ID: 1119432149_1119432153

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1119432149 1119432153
Species Human (GRCh38) Human (GRCh38)
Location 14:74575440-74575462 14:74575489-74575511
Sequence CCACATACAGCTGCACAGGCTGT TCACAGAGACTATAATGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 215} {0: 1, 1: 0, 2: 1, 3: 26, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!