ID: 1119445613_1119445620

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1119445613 1119445620
Species Human (GRCh38) Human (GRCh38)
Location 14:74661063-74661085 14:74661087-74661109
Sequence CCATGGACAGCAATCAGGGAAGG TGAAAGGGCAAGAGTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 177} {0: 1, 1: 1, 2: 14, 3: 52, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!