ID: 1119472641_1119472649

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1119472641 1119472649
Species Human (GRCh38) Human (GRCh38)
Location 14:74909366-74909388 14:74909402-74909424
Sequence CCCACAGGGTACTCCCAGGAGCC TCCAGCCTAGGCCCCCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120} {0: 1, 1: 1, 2: 0, 3: 27, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!