ID: 1119472641_1119472660

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1119472641 1119472660
Species Human (GRCh38) Human (GRCh38)
Location 14:74909366-74909388 14:74909417-74909439
Sequence CCCACAGGGTACTCCCAGGAGCC CTGAAAGGCTGGCTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120} {0: 1, 1: 0, 2: 5, 3: 64, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!