ID: 1119478111_1119478123

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1119478111 1119478123
Species Human (GRCh38) Human (GRCh38)
Location 14:74942744-74942766 14:74942792-74942814
Sequence CCAAGCACAGACGGGGCGGGTAT CCTCCTATGGAGGAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 1, 3: 36, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!