ID: 1119538019_1119538020

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1119538019 1119538020
Species Human (GRCh38) Human (GRCh38)
Location 14:75418981-75419003 14:75418994-75419016
Sequence CCAACTCTGTGGTCTGAAATATA CTGAAATATACTCTCGTACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 196} {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!