ID: 1119539270_1119539285

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1119539270 1119539285
Species Human (GRCh38) Human (GRCh38)
Location 14:75428125-75428147 14:75428167-75428189
Sequence CCGGGCCGGGACAGGCCTGGGCA CGGGCGGCAGCGGCGCGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 418} {0: 1, 1: 0, 2: 8, 3: 88, 4: 1163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!