ID: 1119554465_1119554477

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1119554465 1119554477
Species Human (GRCh38) Human (GRCh38)
Location 14:75542617-75542639 14:75542667-75542689
Sequence CCCCAGATCAGCCACTTCCTCCT TAAGTGTCAGGCTGGCTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 430} {0: 1, 1: 0, 2: 1, 3: 19, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!