ID: 1119597237_1119597240

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1119597237 1119597240
Species Human (GRCh38) Human (GRCh38)
Location 14:75946590-75946612 14:75946621-75946643
Sequence CCAAGCATCTTCTGTGTGTTCAG TAGGCACTAGGCACAAGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 311} {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!