ID: 1119613098_1119613106

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1119613098 1119613106
Species Human (GRCh38) Human (GRCh38)
Location 14:76080320-76080342 14:76080355-76080377
Sequence CCTCTGATCTGTCACAGATGGGC CTTTGTGCACATTTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115} {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!