ID: 1119613631_1119613644

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1119613631 1119613644
Species Human (GRCh38) Human (GRCh38)
Location 14:76083994-76084016 14:76084043-76084065
Sequence CCTTAGTGACGCAGCACTGCCAC CAGCGGAGGGAGGAGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70} {0: 1, 1: 1, 2: 7, 3: 85, 4: 867}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!