ID: 1119763902_1119763915

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1119763902 1119763915
Species Human (GRCh38) Human (GRCh38)
Location 14:77175961-77175983 14:77175998-77176020
Sequence CCGGTGGGGTCTTGGTGAGTGGG CAGGGGTAAGAGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 267} {0: 1, 1: 0, 2: 1, 3: 78, 4: 769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!