ID: 1119783726_1119783733

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1119783726 1119783733
Species Human (GRCh38) Human (GRCh38)
Location 14:77297017-77297039 14:77297043-77297065
Sequence CCACAAAGGCGTGACAATGTGTG TGGTGGGAATGGTGGGAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135} {0: 1, 1: 0, 2: 0, 3: 52, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!