ID: 1119899494_1119899496

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1119899494 1119899496
Species Human (GRCh38) Human (GRCh38)
Location 14:78247907-78247929 14:78247932-78247954
Sequence CCAGTGTCTCTGAAGAGTTCATT GCATGAAGTCAGCCTGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 227} {0: 1, 1: 0, 2: 2, 3: 12, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!