ID: 1119929376_1119929383

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1119929376 1119929383
Species Human (GRCh38) Human (GRCh38)
Location 14:78530178-78530200 14:78530218-78530240
Sequence CCCTCCAGACACCAGGGCTGTGA AGGCCCAGAGTCAGCTTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 329} {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!